249_300090, 249_300090 (genetic_marker) Fragaria iinumae

Marker Overview
Name249_300090
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
249_300090249_300090-60.219Fragaria iinumaemarker_locus
249_300090249_300090Fragaria iinumaemarker_locus


Sequence
>249_300090 ID=249_300090|Name=249_300090|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GACAAAGCAGGCCTCATCATATAAGAGGAATGCATGTTTTCAATCTGGAT
ACACGAATTACCAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22249_300090-60.219View
2Fragaria-Fii3N/A60.22249_300090View