TP1129, TP1129 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP1129
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP1129TP1129-60.219Fragaria iinumaemarker_locus
TP1129TP1129Fragaria iinumaemarker_locus


Sequence
>TP1129 ID=TP1129|Name=TP1129|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGACCCTAAAGAAATTTTGCAGTCACGACCATCTTTGTTACGATACT
GGACTACTGGTATA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22TP1129-60.219View
2Fragaria-Fii3N/A60.22TP1129View