TP4774, TP4774 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP4774
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP4774TP4774-60.219Fragaria iinumaemarker_locus
TP4774TP4774Fragaria iinumaemarker_locus


Sequence
>TP4774 ID=TP4774|Name=TP4774|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCGTTTGCGGGATCATCAAGTCAGGGTTCTCCCCCAAGTTGGACGG
AATCTCCACGCTGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22TP4774-60.219View
2Fragaria-Fii3N/A60.22TP4774View