245_297927, 245_297927 (genetic_marker) Fragaria iinumae

Marker Overview
Name245_297927
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
245_297927245_297927-60.219Fragaria iinumaemarker_locus
245_297927245_297927Fragaria iinumaemarker_locus


Sequence
>245_297927 ID=245_297927|Name=245_297927|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TTTATCCATACGAACGATTAACTGTCAATTCCAAAGACCCGGAAACCAGC
ATAGACATAACCAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22245_297927-60.219View
2Fragaria-Fii3N/A60.22245_297927View