TP2325, TP2325 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2325
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2325TP2325-60.219Fragaria iinumaemarker_locus
TP2325TP2325Fragaria iinumaemarker_locus


Sequence
>TP2325 ID=TP2325|Name=TP2325|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGATGCAAGGCATCTCTCTAGTGATGTGAATTTCAGTCCAGACAAGG
GTGAGAGTGAGTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22TP2325-60.219View
2Fragaria-Fii3N/A60.22TP2325View