TP1114, TP1114 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP1114
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP1114TP1114-60.219Fragaria iinumaemarker_locus
TP1114TP1114Fragaria iinumaemarker_locus


Sequence
>TP1114 ID=TP1114|Name=TP1114|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGACCCAAGTCTCCTTGGAGACCTCCATGGACAGCTTCGGCTCGCAC
ATCATTAGCAGGAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A60.22TP1114-60.219View
2Fragaria-Fii3N/A60.22TP1114View