240_241980, 240_241980 (genetic_marker) Fragaria iinumae

Marker Overview
Name240_241980
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
240_241980240_241980-61.19Fragaria iinumaemarker_locus
240_241980240_241980Fragaria iinumaemarker_locus


Sequence
>240_241980 ID=240_241980|Name=240_241980|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TCAAACTCAACATAATCTGTTTTCTTTTTTTCTTCAACTGCAATTTGCTA
AAGCTTTCAACTTT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A61.19240_241980-61.19View
2Fragaria-Fii3N/A61.19240_241980View