49_345349, 49_345349 (genetic_marker) Fragaria iinumae

Marker Overview
Name49_345349
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
49_34534949_345349-61.19Fragaria iinumaemarker_locus
49_34534949_345349Fragaria iinumaemarker_locus


Sequence
>49_345349 ID=49_345349|Name=49_345349|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ATATTAAGCTAACGTAGAAGAGAAAGAGAGGRGGAAGGAACATGCATTAA
CAAAGCAATCGTGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A61.1949_345349-61.19View
2Fragaria-Fii3N/A61.1949_345349View