TP7807, TP7807 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP7807
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP7807TP7807-61.673Fragaria iinumaemarker_locus
TP7807TP7807Fragaria iinumaemarker_locus


Sequence
>TP7807 ID=TP7807|Name=TP7807|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTAATCGGCTGTTCTTGTTTCTTTAGATACGCGTTACATTTGACAG
GTTTCTTCTGTTAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A61.67TP7807-61.673View
2Fragaria-Fii3N/A61.67TP7807View