35_831787, 35_831787 (genetic_marker) Fragaria iinumae

Marker Overview
Name35_831787
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
35_83178735_831787-61.673Fragaria iinumaemarker_locus
35_83178735_831787Fragaria iinumaemarker_locus


Sequence
>35_831787 ID=35_831787|Name=35_831787|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GATTGCAGAATATGCGCAAGAGCTGACGATTGCAAATGAAAAATTACAGG
GCTCAAAAGAACAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A61.6735_831787-61.673View
2Fragaria-Fii3N/A61.6735_831787View