TP2422, TP2422 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2422
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2422TP2422-61.673Fragaria iinumaemarker_locus
TP2422TP2422Fragaria iinumaemarker_locus


Sequence
>TP2422 ID=TP2422|Name=TP2422|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGATGTGTTTACTATGGAATTGATAGGTGCTTTATTGTGTAAGGATG
TAGTAGATCCGAGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A61.67TP2422-61.673View
2Fragaria-Fii3N/A61.67TP2422View