TP3541, TP3541 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3541
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3541TP3541-65.576Fragaria iinumaemarker_locus
TP3541TP3541Fragaria iinumaemarker_locus


Sequence
>TP3541 ID=TP3541|Name=TP3541|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCATAACACACATTGATCATAAGTCCTTAGTTACTGCAACACAAAT
GCATTACTAACAAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A65.58TP3541-65.576View
2Fragaria-Fii3N/A65.58TP3541View