106_306382, 106_306382 (genetic_marker) Fragaria iinumae

Marker Overview
Name106_306382
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
106_306382106_306382-66.542Fragaria iinumaemarker_locus
106_306382106_306382Fragaria iinumaemarker_locus


Sequence
>106_306382 ID=106_306382|Name=106_306382|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ATAAAGAAGACATAGAATTTTGCTGCAATCCCGTCATATTGTTCTGCTGC
ATTGTTGGCACAGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii3N/A66.54106_306382-66.542View
2Fragaria-Fii3N/A66.54106_306382View