198_313481, 198_313481 (genetic_marker) Fragaria iinumae

Marker Overview
Name198_313481
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
198_313481198_313481-62.683Fragaria iinumaemarker_locus
198_313481198_313481Fragaria iinumaemarker_locus


Sequence
>198_313481 ID=198_313481|Name=198_313481|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ATCCAGGGTTAATTTTATATGGATTAAATATTTTCATTGAAATGTCGCCC
AACAGCGAAAGAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A62.68198_313481-62.683View
2Fragaria-Fii5N/A62.68198_313481View