54_13316, 54_13316 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_13316
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_1331654_13316-62.683Fragaria iinumaemarker_locus
54_1331654_13316Fragaria iinumaemarker_locus


Sequence
>54_13316 ID=54_13316|Name=54_13316|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GTATTGAGCTCGGGCATTGTCTTGTAAACAAGGCAAAGATAACCACTTCA
CAGCTTCCTCTAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A62.6854_13316-62.683View
2Fragaria-Fii5N/A62.6854_13316View