TP3741, TP3741 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP3741
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP3741TP3741-62.683Fragaria iinumaemarker_locus
TP3741TP3741Fragaria iinumaemarker_locus


Sequence
>TP3741 ID=TP3741|Name=TP3741|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCATTTGTTTTTGTTTATTGAAAGAAAGAAAATGGAAAGAGGTTTG
AAATGTTTTGCTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A62.68TP3741-62.683View
2Fragaria-Fii5N/A62.68TP3741View