54_85619, 54_85619 (genetic_marker) Fragaria iinumae

Marker Overview
Name54_85619
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
54_8561954_85619-62.683Fragaria iinumaemarker_locus
54_8561954_85619Fragaria iinumaemarker_locus


Sequence
>54_85619 ID=54_85619|Name=54_85619|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CGCTCTTTGATGGGTCGCCTTTCTCTTATCCYGATCTCTCTCAAGTCTGA
GTTTATAGAGAGAT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A62.6854_85619-62.683View
2Fragaria-Fii5N/A62.6854_85619View