TP4085, TP4085 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP4085
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP4085TP4085-62.683Fragaria iinumaemarker_locus
TP4085TP4085Fragaria iinumaemarker_locus


Sequence
>TP4085 ID=TP4085|Name=TP4085|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCCCTGCTGGTGAACTGTCCTGCTGTATTTTCCTATTCCTTGTAGG
GTTGTGGTGTAACC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii5N/A62.68TP4085-62.683View
2Fragaria-Fii5N/A62.68TP4085View