TP660, TP660 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP660
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP660TP660-1.764Fragaria iinumaemarker_locus
TP660TP660Fragaria iinumaemarker_locus


Sequence
>TP660 ID=TP660|Name=TP660|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAAGGCATCTGCCTAGGCTCTGATAGTGAAAGCCTCCTAGGCTTTG
CTGATCCTGCTTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A1.76TP660-1.764View
2Fragaria-Fii6N/A1.76TP660View