TP5394, TP5394 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP5394
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP5394TP5394-4.453Fragaria iinumaemarker_locus
TP5394TP5394Fragaria iinumaemarker_locus


Sequence
>TP5394 ID=TP5394|Name=TP5394|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCTGCTTTAACTTACATTAAGTAATTATACAGCGAGACCCTGCAAT
AACATTATTTATTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A4.45TP5394-4.453View
2Fragaria-Fii6N/A4.45TP5394View