TP1610, TP1610 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP1610
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP1610TP1610-15.402Fragaria iinumaemarker_locus
TP1610TP1610Fragaria iinumaemarker_locus


Sequence
>TP1610 ID=TP1610|Name=TP1610|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAGCCTAATGGAAACCTTAAACTCTACAGAGCCGCATTATATCAGA
TGTGTAAAGCCAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A15.4TP1610-15.402View
2Fragaria-Fii6N/A15.4TP1610View