TP4197, TP4197 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP4197
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP4197TP4197-24.22Fragaria iinumaemarker_locus
TP4197TP4197Fragaria iinumaemarker_locus


Sequence
>TP4197 ID=TP4197|Name=TP4197|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCCTAATGTCGTTCACTGGCAGCTGCTTAAATAGGGACTTAAGTGA
GAAAAGTGCTAATT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A24.22TP4197-24.22View
2Fragaria-Fii6N/A24.22TP4197View