235_311897, 235_311897 (genetic_marker) Fragaria iinumae

Marker Overview
Name235_311897
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
235_311897235_311897-28.496Fragaria iinumaemarker_locus
235_311897235_311897Fragaria iinumaemarker_locus


Sequence
>235_311897 ID=235_311897|Name=235_311897|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ACTTGAGATATGTAGGCGTGAGCGAAAGAGTCAGCATTGAGGTTTCCTTC
CAGAGATTCAGTTA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A28.5235_311897-28.496View
2Fragaria-Fii6N/A28.5235_311897View