TP6345, TP6345 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP6345
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP6345TP6345-30.014Fragaria iinumaemarker_locus
TP6345TP6345Fragaria iinumaemarker_locus


Sequence
>TP6345 ID=TP6345|Name=TP6345|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGCAAAGAGGAGCTCACTATTCGACACGTGTACTATCTGAGTGAAA
CAAAGTAAATCGAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A30.01TP6345-30.014View
2Fragaria-Fii6N/A30.01TP6345View