TP39, TP39 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP39
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP39TP39-30.014Fragaria iinumaemarker_locus
TP39TP39Fragaria iinumaemarker_locus


Sequence
>TP39 ID=TP39|Name=TP39|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAAAACCTCCAAGGCTAAACTACAAGAAAAGGCAGATCAGAAAGGC
TCCAAGGTTGAACA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A30.01TP39-30.014View
2Fragaria-Fii6N/A30.01TP39View