TP2387, TP2387 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2387
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2387TP2387-32.932Fragaria iinumaemarker_locus
TP2387TP2387Fragaria iinumaemarker_locus


Sequence
>TP2387 ID=TP2387|Name=TP2387|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGATGGTGAAATAAAGGATCTAGCTGATCGTATCCATTATCAGGGGT
TTAGTAAATCTTAC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A32.93TP2387-32.932View
2Fragaria-Fii6N/A32.93TP2387View