12_708204, 12_708204 (genetic_marker) Fragaria iinumae

Marker Overview
Name12_708204
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
12_70820412_708204-36.976Fragaria iinumaemarker_locus
12_70820412_708204Fragaria iinumaemarker_locus


Sequence
>12_708204 ID=12_708204|Name=12_708204|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CATCCTCTCTCTCTCTCTCTCTCTCTCTCTCTGAAATCCTAATACGGATT
CATATACGTATACG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A36.9812_708204-36.976View
2Fragaria-Fii6N/A36.9812_708204View