TP2989, TP2989 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP2989
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP2989TP2989-44.672Fragaria iinumaemarker_locus
TP2989TP2989Fragaria iinumaemarker_locus


Sequence
>TP2989 ID=TP2989|Name=TP2989|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCAATTCAACACAAATCACCTATCTGTCTATTCTAACCTCGGTCCA
TAGGGACTTCAGTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A44.67TP2989-44.672View
2Fragaria-Fii6N/A44.67TP2989View