60_41600, 60_41600 (genetic_marker) Fragaria iinumae

Marker Overview
Name60_41600
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
60_4160060_41600-44.672Fragaria iinumaemarker_locus
60_4160060_41600Fragaria iinumaemarker_locus


Sequence
>60_41600 ID=60_41600|Name=60_41600|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TACTCCCCAGTCCGCACACGAAAACTTTATAAAGCAATTCCCTCCTCCTT
GAAACTAAAATTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A44.6760_41600-44.672View
2Fragaria-Fii6N/A44.6760_41600View