360_116973, 360_116973 (genetic_marker) Fragaria iinumae

Marker Overview
Name360_116973
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
360_116973360_116973-44.672Fragaria iinumaemarker_locus
360_116973360_116973Fragaria iinumaemarker_locus


Sequence
>360_116973 ID=360_116973|Name=360_116973|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CGCGTGGAGGAGGAGGAGCGCGTCAAGAATTSGGAAGAGGAGGCGGAGAA
AGTGGATGAGGTGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A44.67360_116973-44.672View
2Fragaria-Fii6N/A44.67360_116973View