328_167554, 328_167554 (genetic_marker) Fragaria iinumae

Marker Overview
Name328_167554
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
328_167554328_167554-45.643Fragaria iinumaemarker_locus
328_167554328_167554Fragaria iinumaemarker_locus


Sequence
>328_167554 ID=328_167554|Name=328_167554|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AAAGGCAGCTCAGATGGGAGCGACCATGAGCAGCAGCACCACCACATCAG
GTTCGCTCTCGGTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A45.64328_167554-45.643View
2Fragaria-Fii6N/A45.64328_167554View