TP4681, TP4681 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP4681
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP4681TP4681-45.643Fragaria iinumaemarker_locus
TP4681TP4681Fragaria iinumaemarker_locus


Sequence
>TP4681 ID=TP4681|Name=TP4681|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGCGTTCCACGTAGGACGTCGACGCCTAACTGCTGCACGCCGTCTTC
CTCCACCGCCAAAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A45.64TP4681-45.643View
2Fragaria-Fii6N/A45.64TP4681View