2_1366272, 2_1366272 (genetic_marker) Fragaria iinumae

Marker Overview
Name2_1366272
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
2_13662722_1366272-45.643Fragaria iinumaemarker_locus
2_13662722_1366272Fragaria iinumaemarker_locus


Sequence
>2_1366272 ID=2_1366272|Name=2_1366272|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CAACTCCAGTATTTACTTTTCCAGTCACTTTCTTCATGTCTTGACTTGAA
CTGTTTTGTAGCAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A45.642_1366272-45.643View
2Fragaria-Fii6N/A45.642_1366272View