2_1082711, 2_1082711 (genetic_marker) Fragaria iinumae

Marker Overview
Name2_1082711
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
2_10827112_1082711-45.643Fragaria iinumaemarker_locus
2_10827112_1082711Fragaria iinumaemarker_locus


Sequence
>2_1082711 ID=2_1082711|Name=2_1082711|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGTTTGACAGCAAATCAGCTGCCCGACGTCTRTTGAAGCAAGGGGGGCTT
TACTTGAACAACTC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A45.642_1082711-45.643View
2Fragaria-Fii6N/A45.642_1082711View