67_665269, 67_665269 (genetic_marker) Fragaria iinumae

Marker Overview
Name67_665269
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
67_66526967_665269-52.42Fragaria iinumaemarker_locus
67_66526967_665269Fragaria iinumaemarker_locus


Sequence
>67_665269 ID=67_665269|Name=67_665269|organism=Fragaria iinumae|type=genetic_marker|length=64bp
AAGAAGAAGAAAACTGAACCAAACCTGTTGAGGTGAAGAAGCTGCAGAAA
CCAATCCCAAACAG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A52.4267_665269-52.42View
2Fragaria-Fii6N/A52.4267_665269View