TP332, TP332 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP332
dbSNP IDN/A
TypeSNP
SNP AllelesA/C
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP332TP332-53.874Fragaria iinumaemarker_locus
TP332TP332Fragaria iinumaemarker_locus


Sequence
>TP332 ID=TP332|Name=TP332|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAAATTTACAAGAGTAACATGTCAGATAATGGTAAGAAAGGCATCT
CCGAGATCGGAAGA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A53.87TP332-53.874View
2Fragaria-Fii6N/A53.87TP332View