TP7165, TP7165 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP7165
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP7165TP7165-54.84Fragaria iinumaemarker_locus
TP7165TP7165Fragaria iinumaemarker_locus


Sequence
>TP7165 ID=TP7165|Name=TP7165|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGTAACACATGTACATTACATACACCATCCTTACAGAATCCCTCTA
TTCATATTAAGTGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A54.84TP7165-54.84View
2Fragaria-Fii6N/A54.84TP7165View