107_396030, 107_396030 (genetic_marker) Fragaria iinumae

Marker Overview
Name107_396030
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
107_396030107_396030-57.753Fragaria iinumaemarker_locus
107_396030107_396030Fragaria iinumaemarker_locus


Sequence
>107_396030 ID=107_396030|Name=107_396030|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CAGCCTCAACACAAAGCAAGGTTCAAGAATAATCTGCAGCTGTTCTGATT
TCAAACTCATTAGT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A57.75107_396030-57.753View
2Fragaria-Fii6N/A57.75107_396030View