107_395974, 107_395974 (genetic_marker) Fragaria iinumae

Marker Overview
Name107_395974
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
107_395974107_395974-57.753Fragaria iinumaemarker_locus
107_395974107_395974Fragaria iinumaemarker_locus


Sequence
>107_395974 ID=107_395974|Name=107_395974|organism=Fragaria iinumae|type=genetic_marker|length=64bp
CGTATTCTAATCCTACCGACCATGCCATTCAWAAGTTAAATTCAAGGGAG
ATGCATCAGCCTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A57.75107_395974-57.753View
2Fragaria-Fii6N/A57.75107_395974View