14_1131487, 14_1131487 (genetic_marker) Fragaria iinumae

Marker Overview
Name14_1131487
dbSNP IDN/A
TypeSNP
SNP AllelesC/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
14_113148714_1131487-61.154Fragaria iinumaemarker_locus
14_113148714_1131487Fragaria iinumaemarker_locus


Sequence
>14_1131487 ID=14_1131487|Name=14_1131487|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TCGACGGGCAAATTCGCCGGAATGTTACCTCGTCCGTCTCGGCTGCCGTG
GATTCTTCCGACCC
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii6N/A61.1514_1131487-61.154View
2Fragaria-Fii6N/A61.1514_1131487View