150_248012, 150_248012 (genetic_marker) Fragaria iinumae

Marker Overview
Name150_248012
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
150_248012150_248012-0.483Fragaria iinumaemarker_locus
150_248012150_248012Fragaria iinumaemarker_locus


Sequence
>150_248012 ID=150_248012|Name=150_248012|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ATATTATCATCAATCTAACTATAATGTGTGTTGAGAGAGAGAGAGACACA
CACACACACATACT
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A0.48150_248012-0.483View
2Fragaria-Fii7N/A0.48150_248012View