150_248013, 150_248013 (genetic_marker) Fragaria iinumae

Marker Overview
Name150_248013
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
150_248013150_248013-0.483Fragaria iinumaemarker_locus
150_248013150_248013Fragaria iinumaemarker_locus


Sequence
>150_248013 ID=150_248013|Name=150_248013|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TATTATCATCAATCTAACTATAATGTGTGTTGAGAGAGAGAGAGACACAC
ACACACACATACTG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A0.48150_248013-0.483View
2Fragaria-Fii7N/A0.48150_248013View