47_716937, 47_716937 (genetic_marker) Fragaria iinumae

Marker Overview
Name47_716937
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
47_71693747_716937-0.483Fragaria iinumaemarker_locus
47_71693747_716937Fragaria iinumaemarker_locus


Sequence
>47_716937 ID=47_716937|Name=47_716937|organism=Fragaria iinumae|type=genetic_marker|length=64bp
GCGACCATTCATTGTCCCAGCACCTTCAATTTATCGAGGCAGGACTGTGG
GCCGTAGGGATCAA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A0.4847_716937-0.483View
2Fragaria-Fii7N/A0.4847_716937View