47_159479, 47_159479 (genetic_marker) Fragaria iinumae

Marker Overview
Name47_159479
dbSNP IDN/A
TypeSNP
SNP AllelesG/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
47_15947947_159479-1.454Fragaria iinumaemarker_locus
47_15947947_159479Fragaria iinumaemarker_locus


Sequence
>47_159479 ID=47_159479|Name=47_159479|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ATCAAGATGAGCACTCTTTATAGACGACGACGGACTCATTTTGATCACTC
TATTTCCATCAGGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A1.4547_159479-1.454View
2Fragaria-Fii7N/A1.4547_159479View