TP1899, TP1899 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP1899
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP1899TP1899-2.42Fragaria iinumaemarker_locus
TP1899TP1899Fragaria iinumaemarker_locus


Sequence
>TP1899 ID=TP1899|Name=TP1899|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAGTGTACAAAACAAATGATCAGAAAACAAAGATTTCATATACACA
CATAACTCAATTCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A2.42TP1899-2.42View
2Fragaria-Fii7N/A2.42TP1899View