TP5933, TP5933 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP5933
dbSNP IDN/A
TypeSNP
SNP AllelesA/G
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP5933TP5933-2.903Fragaria iinumaemarker_locus
TP5933TP5933Fragaria iinumaemarker_locus


Sequence
>TP5933 ID=TP5933|Name=TP5933|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGGAATATAATATAGTGCGTCAGCTTGGAATGTATTAGAAAAAGATA
AGCTCAAACAAATA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A2.9TP5933-2.903View
2Fragaria-Fii7N/A2.9TP5933View