TP941, TP941 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP941
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP941TP941-5.328Fragaria iinumaemarker_locus
TP941TP941Fragaria iinumaemarker_locus


Sequence
>TP941 ID=TP941|Name=TP941|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGAATTTTTATTGGAAGAGCTTCTCTCAGCAGCTACAGATTGGTGAT
CCAAGGGTTCATCA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A5.33TP941-5.328View
2Fragaria-Fii7N/A5.33TP941View