TP8559, TP8559 (genetic_marker) Fragaria iinumae

Marker Overview
NameTP8559
dbSNP IDN/A
TypeSNP
SNP AllelesA/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TP8559TP8559-32.192Fragaria iinumaemarker_locus
TP8559TP8559Fragaria iinumaemarker_locus


Sequence
>TP8559 ID=TP8559|Name=TP8559|organism=Fragaria iinumae|type=genetic_marker|length=64bp
TGCAGTCTGTTCAAGATACATAAGCTAAAGAGTTAGTATATAGTAATGAA
ATGGATTATGAAGG
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A32.19TP8559-32.192View
2Fragaria-Fii7N/A32.19TP8559View