17_246286, 17_246286 (genetic_marker) Fragaria iinumae

Marker Overview
Name17_246286
dbSNP IDN/A
TypeSNP
SNP AllelesC/T
SpeciesFragaria iinumae
Publication[view all]
CommentGBS SNP
Relationships

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
17_24628617_246286-33.163Fragaria iinumaemarker_locus
17_24628617_246286Fragaria iinumaemarker_locus


Sequence
>17_246286 ID=17_246286|Name=17_246286|organism=Fragaria iinumae|type=genetic_marker|length=64bp
ATCTCTGCAAAGAATGATAACACCCAGGTTTTAGAAATCATTTCTTTCTA
GATGAAAGCATACA
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Fragaria-Fii7N/A33.1617_246286-33.163View
2Fragaria-Fii7N/A33.1617_246286View