4CL11, 4CL11 (gene) Pyrus x bretschneideri

Gene Overview
Name 4CL11
Gene Symbol 4CL11
Type gene
Organism Pyrus x bretschneideri
Synonym 4-coumaroyl CoA ligase
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
GDR Gene Database2015-01-04
Relationships

The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
4CL11KM455955.1-4CL11.m1Pyrus x bretschneiderimRNA


The following gene_class feature(s) contains this gene:

Feature NameUnique NameSpeciesType
S-locus F-box proteinSFBPyrus x bretschneiderigene_class


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Type Gene/mRNA Name Genome Location NCBI Accession
mRNA parsed from NCBI nr database KM455955.1-4CL11.m1 N/A KM455955.1

Sequence(s):
>KM455955.1-4CL11.m11644
atggagcaccatcacaaagatgatgagttcattttccggtcgaaactccccgatatttacatcccaaaccacctccctct
ccacacctactgcttcgaaaacatctcccaattcatggaccgcccctgcttgatcaacggcaacaacggcgacaccttca
cctacgccgacgtcgagctcacctcccgcaaggtcgcctcggggctccacaaaatcggcattcaccaaaccgacgtcatc
atgctcctcctccaaaacagccctgaattcgtctttgcatttctcggcgcctccaatatcggcgcagtcgtcaccaccgc
caaccccttctacactccagccgagatggccaagcaggcaaaagcatccaatgccaaactcatcataacgcggtcggctt
acgtggacaaggtgaaggacttcgcacttaaaaacgacgtcgagatcatggtcgtcgacagcgcggaaactgaggaagac
ggtaatacttatcgtcacttctcggagctgacttcggcggacgagaatgacatcccggcagtgaaaatataccccgaaga
tgtcgttgcgctgccgtattcttccgggacgacggggctacctaaaggggttatgctgacgcacaaagggttggtgacga
gcgtggcgcaacaggtggacggagagaatccaaatttgtatttccacagtgaggacgtgatcctctgcgtgctgcccttg
ttccatatctactccctcaattcagtgtttctctgcggactcagagttggggcggcgatactgatcatgcagaagtttga
gatcaccaagttgttggagctggtggagaagtacaaggtgacgattgcgccttttgtacctccgatcgttttgagtattg
ccaaaagccccgacttagaccggtacgacttgtcatcgataaggatggtgatgtccggtgcggcgccgatggggaaggag
cttgaggatacagtgagggctaagttacctaatgccaaacttggacaggggtatggaatgacagaggctggacctgtgct
gtcaatgtgcttagcatttgcaaaggaaccatttgagataaaatcaggtgcgtgcgggactgttgtaagaaatgcagaga
tgaaaattgttgaccctgatacgggtgcttcgcttacgcgaaatcaagctggagagatttgcatcagaggtagccaaatc
atgaaaggttatcttaatgatcctgaagccacggagagaaccgtagacaaacggggatggttgcacacaggtgatatagg
gtacatcgacggtgatgacgagctctttatcgtcgaccgattaaaggaactcatcaaatacagagggttccaagtggctc
cggctgagcttgaagccatgctgattgcccatcccaacatctccgacgctgctgttgtacctatgaaggatgaagctgca
ggtgaaattcctgttgcgtttgttgtgagatcgaacggttccaagatctccgaagatgacatcaaacaatacatctcaaa
acaggtggtcttttataagagaataggtcgggttttcttcatagacaaaatacccaaggctccttctggcaaaatcttga
gaaaagacttgagagcaaagcaggctgcaggcctacccaattag
back to top